clsA [2018-02-13T09:01:59.000Z]

cardiolipin synthase, major enzyme

locus: BSU36590

pI: 9.55

mw: 55.70 kDa

protein length: 482 aa

gene length: 1446 bp

function: biosynthesis of phospholipids

product: cardiolipin synthase, major enzyme

essential: no

synonyms: ywnE

Genomic Context

categories

• [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 3,762,664 → 3,764,112

Phenotypes of a mutant

• increased conjugation of ICEBs1 [Pubmed|26833415]

The protein

Catalyzed reaction/ biological activity

• 2 Phosphatidylglycerol = diphosphatidylglycerol glycerol (according to Swiss-Prot)

Protein family

• Cardiolipin synthase subfamily (according to Swiss-Prot)

Paralogous protein(s)

• [protein|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|YwiE], [protein|B63AAF0D3277FD776944A09D2546F3E48C8716AD|YwjE]

[SW|Localization]

• cell membrane at the septum, this localization depends on two C-terminal helices [Pubmed|26708983,15743965]

Expression and Regulation

Operons

• genes: [gene|2079B210322F26EEC3CCF55611622FADDB1D1BC7|clsA]
  description: [Pubmed|22383849]

Biological materials

Mutant

• BKE36590 (Δ[gene|2079B210322F26EEC3CCF55611622FADDB1D1BC7|clsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTGTAACCCCGCTCAT, downstream forward: _UP4_TAAGATGCGTAAACCCCCGG
• BKK36590 (Δ[gene|2079B210322F26EEC3CCF55611622FADDB1D1BC7|clsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTGTAACCCCGCTCAT, downstream forward: _UP4_TAAGATGCGTAAACCCCCGG

References

• 18820022,14973018,16514141,15743965,26708983,26833415,28376879